rs2365389 chr3:61250788 C>T
- Sequence
cccacaacaataaattcgatgcct[C/T]tttgcctgtttttgaagtagtaat
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- PATZ1_HUMAN ZN524_HUMAN TZAP_HUMAN ZN777_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PATZ1_HUMAN | 2.96 | -3.10 | 1.00 | n/a | No Hit | |||
| ZN524_HUMAN | 2.82 | n/a | 1.00 | n/a | No Hit | |||
| TZAP_HUMAN | 2.71 | -2.78 | 1.00 | n/a | No Hit | |||
| ZN777_HUMAN | 2.82 | n/a | 1.00 | n/a | n/a | |||
| ZN577_HUMAN | 2.38 | n/a | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
EMBL-EBI bmi (adjusted for smoking behaviour), bmi in non-smokers, bmi in smokers, body mass index, body mass index (joint analysis main effects and physical activity interaction), body mass index (joint analysis main effects and smoking interaction), body mass index in physically active individuals
GRASP birth weight, body mass index (bmi), coronary artery disease (cad), diastolic blood pressure (dbp), hdl cholesterol, obesity with early age of onset (age >2), years of education