rs2365452 chr12:94318400 A>C
- Sequence
tctcctcctacttggatgcccttt[A/C]tttctttctttctcttgcctaact
- ASB in cell types
- macrophages form periferal blood THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | 2.88 | -3.73 | 2.00 | |||
| THP-1 (acute monocytic leukemia) | 0.26 | 1.07 | 1.40 |
Items per page:
1 – 2 of 2