rs2366018 chr17:69876868 T>A
- Sequence
tatttttagaatttgtcaagtgaa[T/A]cctcaaatttatatgggaatgcaa
- ASB in cell types
- monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | n/a | 3.81 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Nerve_Tibial, Ovary, Testis, Thyroid