rs2366773 chr5:90642770 C>T
- Sequence
gaccctatgttataaaagtaagta[C/T]gaaaaaaacttccatttattctgt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NFRKB_HUMAN AFF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFRKB_HUMAN | n/a | 3.37 | 2.00 | n/a | n/a | |||
| AFF1_HUMAN | -1.10 | 2.32 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP autism, diabetic retinopathy in type 2 diabetes mellitus, neuroblastoma (brain cancer), paternal transmission distortion, transmission distortion
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Transverse, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Stomach, Thyroid, Whole_Blood