rs2367059 chr10:24575198 A>T
- Sequence
tgggatgatgactatattctaaca[A/T]ttaaaatgctgtcaatactagaac
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.14 | 0.68 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, cystatin c in serum, hdl cholesterol, homa-ir, ldl cholesterol, serum creatinine, total cholesterol, triglycerides