rs2367134 chr3:192899266 T>C
- Sequence
tgaacagccaggcgcggtggctca[T/C]gcctataatcccagcactttggga
- ASB in cell types
- MDM(monocyte derived macrophages) CTV-1 (Adult T acute lymphoblastic leukemia) GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- SPI1_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.53 | 0.41 | 1.52 | n/a | No Hit | |||
| STAG1_HUMAN | 2.01 | -1.32 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Spleen