rs2367486 chr7:142784320 A>G
- Sequence
ccaaacttatggcagtcctagact[A/G]ccctctgatgttcaccatggctta
- ASB in cell types
- pancreas MS-1 (Small cell lung carcinoma) 2588 (Lymphoblastoid Cell Lines) GM12892 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.87 | 2.88 | 1.63 | 3.18 | Concordant | |||
| STAG1_HUMAN | -2.10 | 1.92 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, amyotrophic lateral sclerosis (als), ldl cholesterol, neuroblastoma (brain cancer), refractive error, serum creatinine, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Lung, Minor_Salivary_Gland, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood