rs2367797 chr2:179859783 T>C
- Sequence
ctcaagtaacagaacttgcaatgc[T/C]gtattttgcattctaaaggcattt
- ASB in cell types
- GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | 1.81 | -1.44 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, diastolic blood pressure (dbp), maternal transmission distortion, microalbuminuria, schizophrenia, systolic blood pressure (sbp)