rs2369119 chr4:4507296 A>T
- Sequence
cccaggctcttctggagctggaaa[A/T]gaactcggacctcaaggctcagct
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 1.87 | -0.67 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Stomach, Testis