rs2373571 chr12:101941849 T>C
- Sequence
ctatctgtgaaagatacttccccc[T/C]ctactatcttcagattatcttctt
- ASB in cell types
- monocyte-derived dendritic cells macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | 1.87 | 0.42 | 1.11 | |||
| macrophages form periferal blood | -1.74 | 2.53 | 2.00 |
Items per page:
1 – 2 of 2