rs2374342 chr2:41906402 A>C
- Sequence
cccttcacccagcccagggatcgg[A/C]aactcaatggagagccggtaagca
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- TF65_HUMAN TCF21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 2.60 | -1.82 | 2.00 | -3.76 | Concordant | |||
| TCF21_HUMAN | 2.17 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP anti-hepatitis c virus treatment response (null virologic responder to pegylated interferon-alpha and ribavarin therapy), biploar disorder (bipolar schizoaffective disorder), bipolar disorder, comorbid depressive syndrome and alcohol dependence, fasting insulin, homa-ir, ldl cholesterol, major depressive disorder, simpson-angus scale, tetrology of fallot, type 1 diabetes, rheumatoid arthritis, crohns disease, combined case analysis, gender differentiated
GTEx eQTL Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Pituitary, Testis