rs2374665 chr12:107134773 C>G
- Sequence
gcccacaaggccaccaggggtagg[C/G]aaaagttgtgcctctggcttccct
- ASB in cell types
- foreskin keratinocyte GBM39 (Human brain tumor)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.27 | 1.72 | 1.67 | |||
| GBM39 (Human brain tumor) | -1.11 | 1.62 | 1.00 |
Items per page:
1 – 2 of 2