rs2374734 chr12:107912769 C>T
- Sequence
cagagatcaccctaggaatgtgca[C/T]agggggcagctgccggtggagggt
- ASB in cell types
- GM02630 (Fanconi anemi) GM12878 (female B-cells lymphoblastoid cell line) HEK293 (embryonic kidney) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02630 (Fanconi anemi) | 3.02 | n/a | 1.33 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.53 | 1.22 | 1.04 | |||
| HEK293 (embryonic kidney) | 0.22 | 0.91 | 1.99 | |||
| foreskin keratinocyte | 2.26 | -1.50 | 2.17 | |||
| Jurkat (T-cells) | -0.94 | 1.64 | 1.00 |
Items per page:
1 – 5 of 5