rs237730 chr20:49323953 T>G
- Sequence
gctaaggcaagatttgctcactca[T/G]tgttcagtggcacatcacttcctg
- ASB in cell types
- SW1990 (Pancreatic adenocarcinoma) HCASMC (Human coronary artery smooth muscle cells) MCF7 (Invasive ductal breast carcinoma) AsPC-1 (Pancreatic ductal adenocarcinoma)
- ASB for transcription factors
- BACH1_HUMAN TCF21_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BACH1_HUMAN | 2.75 | n/a | 2.25 | -1.82 | Weak Concordant | |||
| TCF21_HUMAN | 2.14 | n/a | 2.50 | n/a | No Hit | |||
| JUN_HUMAN | 2.06 | -0.05 | 1.67 | -0.99 | Weak Concordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP abnormal involuntary movement scale, adiponectin levels, bipolar disorder and schizophrenia, body mass index (bmi), college completion, height, infant head circumference, stabilized warfarin dose, tardive dyskinesia
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Ovary, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood