rs2377708 chr1:217809588 A>C
- Sequence
gaggcgcattggatttataataac[A/C]aacccttgagggaatgaatccatc
- ASB in cell types
- WA01 (H1, human embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA01 (H1, human embryonic stem cells) | -1.78 | 2.17 | 1.00 |
Items per page:
1 – 1 of 1