rs2380205 chr10:5844771 C>T
- Sequence
caatctgtgtagtcatttgcccta[C/T]ggcgacacaggcagcctgaaacgt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.15 | 1.13 | 1.30 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age-related macular degeneration, birth weight, breast cancer, breast cancer (estrogen receptor positive breast cancer), breast cancer cases only by family history, ldl cholesterol, refractive error, spine bone mineral density (bmd), tetrology of fallot, transmission distortion, treatment outcomes for selective serotonin reuptake inhibitors (ssris) - response at 8 weeks
PheWAS abnormal heart sounds, abnormal thyroid function, acid-base balance disorder, acidosis, acute appendicitis, acute periodontitis, anemia of chronic disease, benign neoplasm of uterus, bladder cancer, bladder cancer and neoplasms, bone cancer, brain cancer, cancer of brain and nervous system, cancer of mouth, cancer of other female genital organs, cancer of other lymphoid, histiocytic tissue, cardiac pacemaker/device in situ, chronic lymphocytic thyroiditis, chronic periodontitis, chronic prostatitis, congenital musculoskeletal deformities of spine, conjunctivitis, infectious, diabetic retinopathy, diseases of pulp and periapical tissues, disorders of lacrimal system, disorders of the pituitary gland and its hypothalamic control, disorders of uterus, nec, disorders of vitreous body, dry eyes, dystrophy of female genital tract, eating disorder, erectile dysfunction, excessive or frequent menstruation, heartburn, hemorrhage or hematoma complicating a procedure, hepatic cancer, primary, hypothyroidism, immune disorders, infection of the eye, inflammatory disease of breast, inflammatory diseases of female pelvic organs, iron metabolism disorder, late effects of cerebrovascular disease, lesions of stomach and duodenum, lipoma, localized adiposity, lymphadenitis, male genital disorders, malignant neoplasm of brain and nervous system, methicillin sensitive staphylococcus aureus, muscle weakness, non-hodgkins lymphoma, noninflammatory disorders of vagina, nonrheumatic pulmonary valve disorders, nonspecific findings on examination of blood, obsessive-compulsive disorder, open wounds of head, neck, and trunk, other and unspecified disc disorder, other benign neoplasm of connective and other soft tissue, other dyschromia, other hemoglobinopathies, other immunological findings, other open wound of head and face, paralysis/spasm of vocal cords or larynx, paroxysmal ventricular tachycardia, pathologic fracture of vertebrae, pelvic inflammatory disease, periapical abscess, periodontitis (acute or chronic), pituitary hypofunction, polycythemia vera, polycythemia vera, secondary, postmenopausal atrophic vaginitis, ptosis of eyelid, pyogenic arthritis, raynauds syndrome, retinal detachments and defects, right bundle branch block, secondary malignancy of brain/spine, septicemia, speech and language disorder, spondylolisthesis, congenital, spontaneous ecchymoses, staphylococcus infections, stiffness of joint, suppurative and unspecified otitis media, swelling, mass, or lump in head and neck, symptoms involving head and neck, traumatic arthropathy, type 2 diabetic ketoacidosis, type 2 diabetic neuropathy, type 2 diabetic retinopathy, unspecified local infection of skin and subcutaneous tissue, upper gastrointestinal congenital anomalies, urinary tract infection, vaginitis and vulvovaginitis, venous embolism & thrombosis, viral enteritis
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid