rs2382993 chr8:124688684 G>A
- Sequence
ccaaaatgtctgtaaacaatcacc[G/A]gctgagagacagaacagagatttt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- IKZF1_HUMAN SKIL_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | -1.19 | 1.76 | 1.00 | n/a | n/a | |||
| SKIL_HUMAN | -2.04 | 2.53 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, fasting insulin, homa-b, homa-ir, microalbuminuria, stabilized warfarin dose, urinary albumin-to-creatinine ratio, waist hip ratio, years of education