rs2383156 chr9:20885241 G>A
- Sequence
ctcttgtacatgaggtaggttccc[G/A]tgtcctcttctttatgttttagtg
- ASB in cell types
- spleen upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| spleen | 2.41 | -2.11 | 1.00 | |||
| upper lobe of left lung | 2.45 | -0.43 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg