rs2384061 chr2:24912751 G>A
- Sequence
aaaataataaacacgaggagtcca[G/A]tgttcacagcaaaatgtcagggaa
- ASB for transcription factors
- ZSCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZSCA4_HUMAN | 2.33 | -4.24 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder in alcoholics, body mass index (bmi), comorbid depressive syndrome and alcohol dependence, diastolic blood pressure (dbp), height, irritible bowel syndrome, major depressive disorder, major depressive disorder (females), major depressive disorder (males), maternal transmission distortion, nicotine dependence (smoking), smoking cessation (nicotine replacement therapy) , nicotine dependence (smoking), smoking cessation (with bupropion hydrochloride), obesity with early age of onset (age >2), paternal transmission distortion, primary rhegmatogenous retinal detachment, recurrent early onset major depressive disorder, rheumatoid arthritis, transmission distortion
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Nerve_Tibial, Ovary, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Thyroid, Whole_Blood