rs2384148 chr10:53090947 G>A
- Sequence
caaaggtctggatggtctacttgg[G/A]gtcaccaatggtcactaggtcccc
- ASB in cell types
- iPS-derived dermal fibroblasts
- ASB for transcription factors
- RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | 2.56 | n/a | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, adiponectin levels, diastolic blood pressure (dbp), hip bone mineral density (bmd), spine bone mineral density (bmd), triglycerides