rs2384678 chr12:115771195 C>T
- Sequence
acgaaatgcctcccaggtctatgc[C/T]catggagaatgggaggttagagta
- ASB in cell types
- VCaP (prostate carcinoma) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 1.37 | 0.34 | 1.25 | |||
| MS-1 (Small cell lung carcinoma) | -1.63 | 2.03 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), hdl cholesterol change with statins, premature ovarian failure, triglycerides