rs238547 chr16:23348878 T>C
- Sequence
aggcttcaagaccatggacttccc[T/C]gccgtcaccatctgcaatgctagc
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) GM18526 (B – cells Lymphoblastoid Cell Lines) MS-1 (Small cell lung carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | -2.22 | 2.55 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | n/a | 3.27 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | -1.73 | 2.00 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.14 | 1.61 | 1.17 |
Items per page:
1 – 4 of 4