rs2386642 chr10:5660296 G>A
- Sequence
tccacccacgatacgaccttactg[G/A]ctaggaccgtgtgccaggtgtgga
- ASB in cell types
- MDA-MB-231 (breast adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-231 (breast adenocarcinoma) | 1.77 | -0.42 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Whole_Blood