rs2387181 chr3:377339 A>C
- Sequence
tgggagtggaggggcggagaaaag[A/C]gaaacttgtgaaaaactgagatta
- ASB in cell types
- foreskin keratinocyte GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.08 | 2.33 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -0.44 | 1.78 | 3.00 |
Items per page:
1 – 2 of 2