rs2388486 chr10:8057058 T>C
- Sequence
caatcgtttctgcggatggggcgc[T/C]ctttgcccacgttctgtgcggatc
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM12878 (female B-cells lymphoblastoid cell line) ID00014 (lymphoblastoid cell, DiGeorge syndrome) GM17942 (lymphoblastoid cell)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | -1.19 | 1.56 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.09 | 0.95 | 1.16 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 2.54 | -2.58 | 1.00 | |||
| GM17942 (lymphoblastoid cell) | 1.81 | -1.60 | 1.00 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | 2.10 | -0.34 | 1.00 |
Items per page:
1 – 5 of 8