rs2389240 chr13:95480447 C>A
- Sequence
ccagagctgggctcaggccagatg[C/A]ggaagagagataatgagagaaata
- ASB in cell types
- MDM(monocyte derived macrophages) macrophages form periferal blood monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 2.47 | -0.32 | 2.00 | |||
| macrophages form periferal blood | -0.25 | 2.60 | 2.00 | |||
| monocyte-derived dendritic cells | 0.37 | 1.43 | 1.14 |
Items per page:
1 – 3 of 3