rs2389830 chr7:17696697 A>C
- Sequence
gtgtcccaggggcccctcctagac[A/C]aggccagtggtgaaaattactcag
- ASB in cell types
- A549 (lung carcinoma) SU-DHL-1 (Anaplastic large cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.35 | 0.85 | 2.00 | |||
| SU-DHL-1 (Anaplastic large cell lymphoma) | 1.34 | -0.73 | 1.50 |
Items per page:
1 – 2 of 2