rs2390791 chr7:23539883 C>T
- Sequence
tagtgtttttttttcttttctttt[C/T]tttttaaagagctttctccatcaa
- ASB in cell types
- MDM(monocyte derived macrophages) GM12878 (female B-cells lymphoblastoid cell line) monocyte-derived macrophages from peripheral blood macrophages form periferal blood
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.09 | 1.62 | 1.48 | 0.95 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
