rs2391467 chr1:94384887 A>G
- Sequence
ggcaatgctaagcatagttagagc[A/G]aaaaggctgggcctttctccaaag
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- CDK9_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK9_HUMAN | -0.88 | 1.65 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, adiponectin levels, cleft lip, with or without cleft palate, cleft lip, with or without cleft palate, in european ancestry population, hdl cholesterol change with statins, ldl cholesterol, nonsyndromic cleft lip, serum creatinine, spine bone mineral density (bmd), tetrology of fallot, total cholesterol