rs2392001 chr7:31744422 C>A
- Sequence
aaatctaagactacattcatccag[C/A]taaaaactaccttgaaggattccc
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) adrenal gland THP-1 (acute monocytic leukemia) erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | 0.05 | 0.77 | 1.17 | |||
| adrenal gland | 1.01 | -0.91 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | 0.74 | 1.01 | 1.00 | |||
| erythroid progenitors | 2.48 | n/a | 2.00 | |||
| Kelly (neuroblastoma) | 1.40 | 0.20 | 2.00 |
Items per page:
1 – 5 of 5