rs2392570 chr7:38398990 A>T
- Sequence
ctcagcctcagcacctcagctgtg[A/T]tttttgtcacataaaaaagaactg
- ASB in cell types
- foreskin keratinocyte FT282 (normal human fallopian tube tissue) thoracic aorta hepatocytes
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.25 | 0.21 | 1.35 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Colon_Transverse, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis, Whole_Blood