rs2393372 chr12:117980886 G>A
- Sequence
tgaatgtgcttaatgccacagatt[G/A]tatacttcggttaaatgatacatt
- ASB in cell types
- MSC (mesenchymal stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MSC (mesenchymal stem cells) | 1.44 | -0.46 | 1.10 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, hdl cholesterol change with statins, ldl cholesterol, mitral annular calcium, total cholesterol