rs2393451 chr10:58593276 A>G
- Sequence
cagataaaacccccatctccctgg[A/G]acagagcacctagggaagtgggtg
- ASB in cell types
- monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | 2.02 | -1.68 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Colon_Sigmoid, Colon_Transverse, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Thyroid