rs2393592 chr6:26285332 A>G
- Sequence
ctccaggaacaccttcagaacacc[A/G]cgagtctcctcatagataaggcca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CD34+ hematopoietic stem cells-derived proerythroblasts MM1.S (plasma cell myeloma) MOLT-4 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- NFXL1_HUMAN GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFXL1_HUMAN | 3.59 | 1.18 | 2.00 | n/a | n/a | |||
| GATA1_HUMAN | 1.26 | -0.02 | 2.40 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, bipolar disorder, hdl cholesterol, height, major depressive disorder, total cholesterol, total cholesterol change with statins, type 1 diabetes, combined control dataset
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Liver, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis, Whole_Blood