rs2393892 chr10:62528833 A>G
- Sequence
ctagactactgcaatgtatttcta[A/G]ctaattactaattgctatctctga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ELF1_HUMAN ARI3A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | 2.67 | -2.41 | 1.00 | n/a | No Hit | |||
| ARI3A_HUMAN | -2.60 | 2.70 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, fasting blood glucose, hdl cholesterol, late onset alzheimers disease, prop taste detection threshold, total cholesterol change with statins, triglycerides, urinary albumin-to-creatinine ratio