rs2393904 chr10:62619566 C>T
- Sequence
gaaaaccacggttcactgtaacaa[C/T]gccaaatcattacaagacaaccac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) monocyte-derived macrophages from peripheral blood
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.67 | 0.86 | 1.04 | |||
| monocyte-derived macrophages from peripheral blood | 2.54 | n/a | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, hypertension (early onset hypertension), irritible bowel syndrome, transmission distortion