rs2393971 chr10:63413613 G>A
- Sequence
atgctgccaggtaacttttcttcc[G/A]tttagctgagacaaaaaacggtta
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ARI1B_HUMAN HTF4_HUMAN NFIC_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARI1B_HUMAN | 2.38 | -2.38 | 1.00 | n/a | n/a | |||
| HTF4_HUMAN | 2.38 | -2.07 | 1.00 | n/a | No Hit | |||
| NFIC_HUMAN | 2.47 | -2.13 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), diastolic blood pressure (dbp), fasting blood glucose, fasting insulin, hdl cholesterol, height, homa-ir, serum dihydrotestosterone (dht) level, serum testosterone (t) level, systolic blood pressure (sbp), triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Hypothalamus, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood