rs2394784 chr10:71260002 G>A
- Sequence
gggtttaagctggagcctctaggg[G/A]acaaacaagccaactgccaggcag
- ASB in cell types
- bipolar neuron HS-SY-2(Monophasic synovial sarcoma) transverse colon
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | 2.27 | -0.42 | 1.17 | |||
| HS-SY-2(Monophasic synovial sarcoma) | -1.01 | 1.97 | 2.00 | |||
| transverse colon | 2.17 | -2.16 | 1.00 |
Items per page:
1 – 3 of 3