rs2396301 chr7:111026769 G>A
- Sequence
tatccccacactgctcttaaaccc[G/A]tcaagatttcttttggcatgctgt
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HS-SY-2(Monophasic synovial sarcoma) | 0.98 | 0.60 | 1.19 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cleft lip, with or without cleft palate, in asian ancestry population, college completion, irritible bowel syndrome, parkinsons disease
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood