rs2396463 chr2:227180276 C>A
- Sequence
aaatcttatgagatgaggttccaa[C/A]tgattggaagcaagactgcatgtc
- ASB in cell types
- 22RV1 (prostate carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.82 | n/a | 2.00 | |||
| HEK293 (embryonic kidney) | -0.41 | 1.38 | 1.40 |
Items per page:
1 – 2 of 2