rs2397201 chr6:56053938 G>A
- Sequence
tgtggctgccctctactggggacc[G/A]aaggacgagttctcaattgagttc
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.94 | 0.56 | 1.06 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, decrease in fev1 (in nonasthmatic participants >=30 years old), obesity with early age of onset (age >2), parkinsons disease, total cholesterol, transmission distortion, triglycerides