rs2398625 chr5:3741452 C>T
- Sequence
atctgcaattctgtcaaactctta[C/T]gcagtctatttgcttacactgttt
- ASB in cell types
- KerCT (keratenocytes)
- ASB for transcription factors
- ESR1_HUMAN FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.87 | -0.81 | 2.00 | n/a | No Hit | |||
| FOXA2_HUMAN | -0.81 | 1.72 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), systolic blood pressure (sbp), triglycerides, type 1 diabetes, rheumatoid arthritis, combined case analysis, gender differentiated