rs2398661 chr7:2353997 C>A
- Sequence
aagccacatgcacccaatgcccgt[C/A]ccgtgagcacccgcgcagagcgaa
- ASB in cell types
- HepG2 (hepatoblastoma) HeLa (cervical adenocarcinoma) Ishikawa (endometrial adenocarcinoma) CD14+ monocytes
- ASB for transcription factors
- INT11_HUMAN STAG1_HUMAN STAT1_HUMAN BRCA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| INT11_HUMAN | -0.06 | 1.52 | 1.71 | n/a | n/a | |||
| STAG1_HUMAN | 0.03 | 1.25 | 1.07 | n/a | n/a | |||
| STAT1_HUMAN | 1.50 | -0.73 | 2.00 | n/a | No Hit | |||
| BRCA2_HUMAN | 1.27 | -0.74 | 1.00 | n/a | n/a | |||
| AHR_HUMAN | -0.45 | 1.30 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Testis, Thyroid