rs2399696 chr5:5419434 C>T
- Sequence
aaagtggttcccacaagacgcctt[C/T]caccctaggatgccccagaggatg
- ASB in cell types
- HEK293 (embryonic kidney) THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.09 | 1.05 | 2.72 | |||
| THP-1 (acute monocytic leukemia) | 1.77 | -0.20 | 1.50 |
Items per page:
1 – 2 of 2