rs2399796 chr10:12214560 A>G
- Sequence
gtcagatttatctgtaacagaaag[A/G]aaggcagcctaattggaccttaag
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | 0.47 | 2.23 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, coronary artery disease (cad), homa-b, lung function, predicted ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), years of education
GTEx eQTL Artery_Aorta, Artery_Tibial, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Whole_Blood