rs2400957 chr12:81611259 G>A
- Sequence
tgtgacagggagatatgccgcacc[G/A]tttatgaaccagctcttcagaggg
- ASB in cell types
- PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | n/a | 2.69 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, birth weight, college completion, hdl cholesterol, ldl cholesterol, microalbuminuria, total cholesterol