rs2401868 chr14:90110071 C>A
- Sequence
ccccctccacactaaatgccgatc[C/A]ttgtgacagccaaactacctgccc
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) H929 (plasma cell myeloma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TTC-1240 (Rhabdoid tumor of the kidney) | 2.49 | -2.10 | 1.00 | |||
| H929 (plasma cell myeloma) | 2.36 | -2.38 | 1.00 | |||
| foreskin keratinocyte | -0.35 | 1.51 | 1.50 |
Items per page:
1 – 3 of 3