rs2402059 chr7:116257188 T>G
- Sequence
ctccattgtgtatttctgaggttg[T/G]cattatgagttttaatttatcatc
- ASB in cell types
- BIN-67 (Ovarian small cell carcinoma, hypercalcemic type)
- ASB for transcription factors
- SMRC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMRC1_HUMAN | n/a | 2.08 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Liver, Nerve_Tibial, Pancreas, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood