rs2403015 chr14:101961223 A>G
- Sequence
gcaggctggggaggtgggtcccct[A/G]caagcagaagaaaattccatgcga
- ASB in cell types
- neutrophils from periferal blood MCF7 (Invasive ductal breast carcinoma) HeLa (cervical adenocarcinoma)
- ASB for transcription factors
- PKNX1_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | -2.09 | 2.49 | 1.00 | n/a | No Hit | |||
| RAD21_HUMAN | 0.34 | 1.91 | 1.73 | n/a | n/a |
Items per page:
1 – 2 of 2