rs2403220 chr10:63068455 C>A
- Sequence
gtgaatatacctcccactgctgaa[C/A]tgcacagtttaaaaacggttatga
- ASB in cell types
- CD14+ monocytes MOLM-13(acute monocytic leukemia(AML), Homo sapiens)
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 3.29 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, ldl cholesterol change with statins, serum testosterone (t) level, total cholesterol, total cholesterol change with statins, years of education